SubtiBank SubtiBank
Version comparison:

2019-02-19 20:02:072025-05-30 00:57:11

description

motility regulator, binds to the [[gene|hag ]]mRNA to inhibit its translation

motility regulator, binds to the [[gene|hag]] mRNA to inhibit its translation, promotes the base pairing between the [[gene|sr1]] RNA and the [[gene|ahrC]] mRNA

locus

BSU35370

BSU_35370

product

motility regulator

RNA chaperone, motility regulator

outlinks

bsu

BSU35370

BSU_35370

The protein

Catalyzed reaction/ biological activity

[[protein|CsrA]] binds the ''[[gene|hag]]'' mRNA to inhibit translation [Pubmed|21895793]

[[protein|CsrA]] binds the ''[[gene|hag]]'' mRNA to inhibit translation [Pubmed|21895793]

binds [[gene|sr1]] RNA and [[gene|ahrC]] mRNA to promote their base pairing and to control arginine metabolism [pubmed|31043113]

The protein

Protein family

csrA family (according to Swiss-Prot)

CsrA/RsmA family (single member, according to UniProt)

Biological materials

Mutant

MGNA-A392 (csrA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/392 NBRP B. subtilis, Japan]

GP469 (spc), available in [SW|Stlke] lab

BKE35370 ([[gene|csrA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG

BKK35370 ([[gene|csrA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG

MGNA-A392 (csrA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/392 NBRP B. subtilis, Japan]

GP469 (spc), available in [SW|Jörg Stülke]'s lab

BKE35370 ([[gene|csrA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG

BKK35370 ([[gene|csrA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG

Biological materials

Expression vectors

pGP381 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Stlke] lab

for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP383, available in [SW|Stlke] lab

pGP381 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab

for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP383, available in [SW|Jörg Stülke]'s lab

Biological materials

lacZ fusion

pGP461 (in [[protein|pAC7]]), available in [SW|Stlke] lab

pGP461 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab

References

Reviews

19385727, 22672726, 25251856

19385727, 22672726, 25251856, 32850966

References

Original Publications

16822857, 17555441, 8969505, 21895793, 23144244, 26577401, 27516547, 27551070

16822857, 17555441, 8969505, 21895793, 23144244, 26577401, 27516547, 27551070, 31043113, 31113895, 33106347

The protein

Paralogous protein(s)

[[this]]

The protein

[SW|Domains]

Contacts FliW via its C-terminus (residues 49-58) (according to UniProt)

The protein

[SW|Localization]

cytoplasm (according to UniProt)